Special Issue Open Access Logo

Morphological and preliminary molecular data on freshwater red algae in Tam Dao National Park, Vietnam

An Hoai Nguyen 1
Hong Anh Thi Cao 1
Duc Anh Nguyen 1
Lien Thuy Nguyen 1, *
  1. Faculty of Biology, VNU University of Science, 334 Nguyen Trai, Thanh Xuan, Ha Noi, Viet Nam
Correspondence to: Lien Thuy Nguyen, Faculty of Biology, VNU University of Science, 334 Nguyen Trai, Thanh Xuan, Ha Noi, Viet Nam. Email: [email protected].

Online metrics


Statistics from the website

  • Abstract Views: 2338
  • Galley Views: 840

Statistics from Dimensions

This article is published with open access by Viet Nam National University, Ho Chi Minh City, Viet Nam. This article is distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0) which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.

Abstract

Rhodophyta is one of the oldest and largest groups of algae and is dominated by marine species, while freshwater species are relatively scarce. Although the diversity and distribution of rhodophytes in freshwater plants have been studied worldwide, there are few published records of freshwater red algae in Vietnam. Therefore, this study aimed to preliminarily investigate the morphology and analyze the phylogeny of freshwater red algae in Vietnam. This report provides information about red algal specimens collected in July 2018 and 2022 in the Tam Dao National Park watershed forests. Morphological analysis of the specimens revealed similar characteristics to those of Batrachospermum; however, phylogenetic analysis of the Tam Dao specimens and Batrachospermum placed them into different clades. Data relating to both morphological and molecular characteristics suggest that Tam Dao specimens may represent a new clade within Batrachospermaceae.

INTRODUCTION

Red algae (Rhodophyta) are among the earliest and largest groups of multicellular algae and can be found in both oceans and freshwater bodies. While marine species make up the majority of the Rhodophyta division, freshwater red algae account for less than 5%, with two-thirds of all known species belonging to Batrachospermales and Florideophyceae 1. Freshwater rhodophytes are distinguished from others by unique characteristics, as the predominant photosynthetic pigments in their chloroplasts are phycocyanin or phycoerythrin, resulting in cells that appear blue or red in color. Research on the distribution of red algae has shown that freshwater species occur mainly in oligotrophic running waters. The presence of these bacteria primarily indicates that water reservoirs contain low nutrient concentrations and are minimally contaminated2.

In recent years, the number of research studies on freshwater red algae has increased globally due to the necessity of obtaining molecular knowledge to study the phylogeny and taxonomy of taxa that were previously based solely on morphological features. The combination of morphological and molecular data has significantly contributed to a better understanding of the relationships among genera and species within those genera. A notable outcome of this combined approach was the proposal of six orders: Balbianiales, Thoreales, Acrochaetiales, Batrachospermales, Nemaliales, and Palmariales. Another significant collaborative effort among freshwater red algal experts led to a comprehensive phylogenetic analysis of the order Batrachospermales, incorporating members from genera and sections of Batrachospermum with the aim of establishing better-defined taxonomic categories, especially to address the issue of paraphyly within the genus Batrachospermum. These collaborations led to the suggestion of numerous new genera, including Kumanoa, Sheathia, Torularia, Virescentia, Acarposporophycos, Visia, Montagnia, and Paludicola. Under this revised classification approach, Kumanoa and Sheathia were the two genera with the highest numbers of species within the freshwater red algae1.

Despite significant advancements in rhodophyte taxonomy worldwide, there is limited published information regarding the distribution of red algae in freshwater bodies in Vietnam. Notifications about the occurrence of freshwater red algae in Vietnam are primarily conveyed through oral communication among researchers, often supplemented by occasional observations in certain national parks. The Checklist of Plant Species of Vietnam (2001) records only one species, Batrachospermum moniliforme, within several national parks, such as Ba Be National Park (Bac Kan), Phia Oac – Phia Den National Park (Cao Bang), Tam Dao National Park (Vinh Phuc), and Chu Mom Ray National Park (Kon Tum) 3. In 2010, Nguyen Thuy Lien reported the presence of two species of freshwater rhodophytes in the Ma Da area within the Dong Nai Biosphere Reserve in southern Vietnam 4. However, these occurrence records are relatively vague and lack parameters for molecular analysis.

From that perspective, in this report, we present information about red-algal samples collected from the Tam Dao National Park watershed forests during annual summer schools in 2018 and 2022. This study aimed to provide morphological data and molecular evidence for phylogenetic analysis, with the goal of clarifying the taxonomy of freshwater rhodophytes in Vietnam.

MATERIALS AND METHODS

Sample collection

Samples were collected from the headwater streams of Tam Dao National Park at coordinates 21°49’61.71” North latitude and 105°62’69.93” East longitude. Sample collection took place in two phases: on July 21, 2018 (TD18), and on July 17, 2022 (TD22). The collected algae were divided for various purposes, including DNA extraction, morphological examination, and herbarium voucher preparation. Specimens intended for molecular analyses were rapidly dried using silica gel, while those for morphological and anatomical observations were preserved in 5% formalin. Voucher herbarium specimens have been deposited at the VNU University of Science Herbarium.

Morphological analyses

The morphological characteristics were observed and documented using a Primo Star microscope with an attached camera system (Carl Zeiss, Germany) following the methods described by Chapuis et al. (2017), Entwisle et al. (2009), Evans et al. (2017), Fischer et al. (2020), Rossignolo et al. (2020), Suzuki & Kitayama (2021), and Vis et al. (2012, 2021) 1, 5, 6, 7, 8, 9, 10, 11. Morphological characteristics, including the whorl diameter, fascicle cell number, carposporophyte and carposporangium dimensions, spermatium diameter, and carpogonium dimensions, were measured in 10 to 15 replicates. Algal identification was performed based on observation features following the methods of the Freshwater Algae of North America 2 and Freshwater Red Algae 1.

Molecular analyses

Silica-dried plant material was ground in 200 μl of CTAB using a mortar and pestle. The solution was then vortexed using two glass beads (ø 5 mm) for 30 seconds. DNA was subsequently extracted from the obtained solution following the CTAB extraction protocol 7.

Molecular assays for sample analysis focused on multilocus sequence analysis (MLSA) following the methods of Lam et al., (2016)12. In addition to rbcL, COI-5P (cox1), psaA, psbA, psaB, EF2, cob, 18S rDNA, and 28S rDNA, four other genes—16S rDNA, 23S rDNA, tilS (tRNA(Ile)-lysidine synthase), and trpA (tryptophan synthase alpha subunit)—were included in the study. The typical PCR mixture (25 μl) consisted of 2X OneTaq DNA Polymerase (New England Biolabs, USA), 0.5 μM primers, and 2 μl of DNA. Thermocycler incubation was carried out using a Mastercycler Nexus-PCR Thermal Cycler (Eppendorf, Germany) following the following general conditions: 94 °C for 2 min; 35 cycles of 94 °C for 40 s, 60 °C for 45 s, and 68 °C for 90 s; and 1 cycle at 68 °C for 5 min, followed by holding at 4 °C. The integrity of the PCR products was assessed by electrophoresis for 45 min at 90 V in 1% (w/v) agarose gels in TAE buffer. DNA sequencing was performed by 1st BASE (Axil Scientific Pte. Ltd., Singapore).

Phylogenetic analyses

The sequences were submitted to GenBank and analyzed using the Nucleotide Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The individual genes and a concatenated alignment were subjected to maximum likelihood (ML) analysis using PHYML in the Geneious Prime 2023 plugins with 1000 bootstrap support replicates.

RESULTS

Morphological characteristics

The specimen was undisturbed by human activity and consisted of freshwater streams with shallow rocky soil that were lightly shaded (Figure 1a). The collected thalli ranged from olive-green in full sunlight to dark blue‒green in shaded areas. The morphological characteristics of the specimens from both phases of collection were similar.

Macroscopic gametophytic thalli are olive-green in color, heterotrichous, and uniaxial, with whorls of branches that give rise to a bead-like appearance on the thallus. The thallus lacks an outer cortex and has a mucilaginous consistency. The thalli are monoecious, very mucilaginous, 5 to 17 cm in height, and 600 to 1000 μm wide. They are abundantly and irregularly branched and appear olive green (Figure 1b). Carposporophytes are small and pedunculate. The whorls are ellipsoidal and separated, contiguous and more or less compressed, measuring 50 to 100 μm in diameter, with 1 to 2 peripheral carposporophytes (indicated by the arrow in Figure 1c). The carpogonial branch is composed of cells that are similar in shape and size to primary fascicle cells and pedunculate carposporophytes. Primary branchlets are abundantly branched, with 10 to 13 cell stories. The proximal cells are cylindrical, measuring 8 to 10 μm wide and 50 to 90 μm long. Carpogonium-bearing branches are 60 to 90 μm long and consist of 8 to 11 cells arising from pericentral cells. Carposporangia are ovoidal, measuring 10 to 12 μm wide and 19 to 22 μm long. Carposporophytes are spherical, with a diameter of 100 to 150 μm (indicated by the arrow in Figure 1e). The spermatangia are spherical, with 3 to 10 cell stories (indicated by the arrow in Figure 1f). Carpogonium-bearing branches are 60 to 100 μm long and consist of 8 to 11 cells (Figure 1d). The trichogyne is 15 μm long with a spermatium (Figure 1g).

Molecular analyses

This study designed and utilized 13 pairs of primers following previous studies and based on red algal data from the NCBI. However, only two fragments of 18S rDNA and trpA showed bands in agarose gels, measuring 1500 and 1000 base pairs, respectively. Amplifications for 18S rDNA and trpA were performed through PCRs using the following primers: 18S rDNA.RA. F (5'- CACCTGGTTGATCCTGCCAG -3'), 18S rDNA.RA. R (5'- CTTGTAAGCGTGGGTCATCAG -3'), trpA.RA. F (5'- TCCCTTTCACGGAGGTAACG -3'), and trpA.RA. R (5'- ACTCTACCATTGAGTTAGCAACC -3'). Alignment searches on NCBI indicated that both TD18 and TD22 belong to Batrachospermaceae. For 18S rDNA, the sequences covered more than 99% of the gene fragment, showing homology of more than 98%. Similarly, for trpA, the figures were approximately 81.5% for gene coverage and 77.5% for pairwise similarity.

Separate ML phylogenetic trees for trpA and 18S rDNA were constructed based on the sequences of the samples and Batrachospermaceae taxa to identify the taxonomy of TD18 and TD22 (Figure 2, Figure 3). For the concatenated phylogenetic tree, as not all taxa had corresponding sequences for 18S rDNA and trpA, the concatenated alignment was assembled for genera based on sequences of 18S rDNA and trpA extracted from species in the same genus. Following trimming and concatenation, the final alignment used for examination comprised 2363 bases and was analyzed to determine the relationship between TD18 and TD22 and other genera in Batrachospermaceae (Figure 4).

Figure 1

Morphological characteristics of fresh water algal samples from Tam Dao. a. Habitat of the specimen; b. Whorls of thallus; c. The whorls of a female gametophyte showing carposporophytes within the whorls and exerted (arrowheads); d. Carpogonium-bearing; e. Carposporophytes; f. Spermatangia (arrowheads) produced terminally on the fascicle; g. The trichogyne with a spermatium. Scale bars: 50 µm.

Figure 2

ML phylogeny depicting the relationship of TD18 and TD22 with other genera of Batrachospermaceae based on 18S rDNA using PHYML in the Geneious Prime® 2023 plugins with 1000 bootstrap support replicates.

Figure 3

ML phylogeny depicting the relationship of TD18 and TD22 with other genera of Batrachospermaceae based on trpA sequences using PHYML in the Geneious Prime® 2023 plugins with 1000 bootstrap support replicates.

Figure 4

trpA, 18S rDNA and concatenated trpA-18S rDNA ML phylogeny depicting the relationships of TD18 and TD22 with seven genera of Batrachospermaceae

DISCUSSION

The morphological characteristics of the two Tam Dao samples revealed that these samples were closely related to species of Batrachospermum sensu stricto. These features include large, multibranched filaments in a mucilaginous or gelatinous mass; undifferentiated straight carpogonial branches arising from both fascicle and pericentral cells; carpogonia with club- to urn-shaped trichogynes; and small, globose, pedicellate carposporophytes at various distances from the whorl axis.

In recent years, the taxonomy of the genus Batrachospermum has undergone significant changes. Several sections have been elevated to the genus level, such as Kumanoa (formerly sections Contorta and Hybrida) with the type species is K. virgatodecaisneana (Basionym: Batrachospermum virgatodecaisneanum), Sheathia (formerly section Helminthoidea) with the type species is S. boryana (Basionym: Batrachospermum boryanum), Torularia (synonym Atrophycus, formerly section Setacea) with the type species is T. dillenii (Basionym: Batrachospermum puiggarianum), Virescentia (formerly a section with the same name) with the type species is Virescentia helminthosa (Basionym: Batrachospermum helminthosum), Acarposporophycos (formerly section Acarposporophytum) with the type species is Acarposporophycos brasiliensis (Basionym: Batrachospermum brasiliense), Visia (formerly section Aristata) with the type species is Visia cayennensis (Basionym: Batrachospermum cayennense), Montagnia (formerly section Macrospora) with the type species is Montagnia macrospora (Basionym: Batrachospermum macrosporum), and Paludicola (formerly section Turfosa) with the type species is Paludicolaturfosa (Basionym: Batrachospermum turfosum) 1.

There was only one species of freshwater red algae recorded in Vietnam, and this species was published in the Checklist of Plant Species of Vietnam (2001): Batrachospermum moniliforme, which is now considered a synonym of B. gelatinosum. The characteristics of the carpogonial branches, carposporophytes, and other features of the Tam Dao specimens indicate that their morphological phenotypes are relatively similar to those of the genus Batrachospermum. However, the trichomes of these specimens had an obovoidal shape, which means that they differ from the description of the trichogyne of B. gelatinosum, which is clavate or lanceolate in shape1.

In terms of the taxonomy of B. moniliforme, only B. moniliforme var. pilosissimum has been identified as the true B. moniliforme. Other varieties of this species are now regarded as synonyms of different species. For example, the species B. moniliforme and most of its varieties are currently classified as B. gelatinosum, the type species of Batrachospermum. B. moniliforme var. stagnale has been reclassified as Sheathia boryana, whereas B. moniliforme var. confusum and B. moniliforme var. condensatum are now known as Sheathia confusa. Similarly, B. moniliforme var. nodiflorum has been redirected to Kumanoa nodiflora, and both B. moniliforme var. dillenii and B. moniliforme var. detersum have been changed to Torularia atra 13. The taxonomy of the genus Batrachospermum has changed significantly, and Vietnamese freshwater red algae have also been subjected to these changes.

Identifying closely related species in Batrachospermum sensu stricto based on morphology has proven difficult and remains challenging due to morphological similarities. For instance, the separation of Batrachospermum and Sheathia has relied primarily on the occurrence of heterocortication, which is unique to the majority of species in Sheathia; however, this feature is absent in S. arcuata1. Therefore, in this situation, only DNA sequence data provide a feasible approach.

Both ML phylogenies depicting the relationships of TD18 and TD22 with other genera of Batrachospermaceae, based on 18S rDNA and trpA, revealed that the Tam Dao specimens formed a separate clade with their nearest neighbors, Psilosiphon (Figure 2) and Kumanoa (Figure 3). In Figure 2, the TD samples plot on the same branch as the PsiloSiphon samples; however, the morphological features of the PsiloSiphon samples are completely different from those of the TD samples. TD specimens possessed Batrachospermum sensu stricto characteristics, similar to Kumanoa or Sheathia, whereas Psilosiphon species have cartilaginous thalli, no division into node and internode regions; they are normally unbranched with putative spermatangia, no carpogonia observed, cortex composed of ellipsoidal to obovoidal photosynthetic cells of uniform size in distinct outward radiating rows or filaments; dense medullary filaments composed of cylindrical cells, colorless, in between the outer cortex and the uniaxial central filament. Reproduction is based on putative monosporangia that develop in chains from cortical filaments on the outside of the thallus or adventitious plantlets 1.

In recent years, many new species have been recorded in neighboring countries of Vietnam, including China, Thailand, Japan, and India 1. These species are mainly found in Kumanoa and Sheathia. Therefore, freshwater algae are likely related to these species. However, the phylogenetic trees in Figure 2 and Figure 3 revealed that the Tam Dao samples, Batrachospermum, Kumanoa and Sheathia were separated into different clades. Similarly, the concatenated ML phylogeny representing the association of TD18 and TD22 with several genera of Batrachospermaceae revealed that Tam Dao specimens were more closely related to Kumanoa and Montagnia than to Batrachospermum and Sheathia. Although there are limited data on the 18S rDNA (nuclear DNA) and trpA (chloroplast DNA) genes in freshwater algae, the results of morphological and molecular analysis suggest that Tam Dao specimens form a new clade in Batrachospermum sensu stricto. Additional evidence from DNA sequences, such as rbcl, may be instrumental in fully characterizing the freshwater red algae of Vietnam.

CONCLUSION

Recently, taxonomic research based on the combination of DNA sequence data and morphological characteristics has revealed the species diversity of freshwater red algae, especially within the family Batrachospermaceae. These studies shed light on the phylogenetic analysis of the family Batrachospermaceae and simplified the taxonomic categories. By providing both morphological and molecular data in the first report on freshwater rhodophytes in Vietnam, this research contributes information about rhodophyte diversity in South Asia and may provide new genus data within the family Batrachospermaceae.

Abbreviations

None.

Acknowledgments

This study was financially supported by the Biofund, Faculty of Biology, VNU University of Science.

Author contributions

All authors significantly contributed to this work, read and approve the final manuscript for publication.

Funding

None.

Availability of data and materials

The data and materials used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  1. . Vis ML, Necchi O. Freshwater Red Algae: Phylogeny, taxonomy and biogeography. Springer. Springer International Publishing; 2021. 350 p. :
  2. . Wehr JD. Freshwater Algae of North America: Ecology and Classification (Aquatic Ecology). Academic Press; 2nd edition. 2015. 1066 p. :
  3. . VNU-CRES. Checklist of plant species of Vietnam [Internet]. Agriculture Publishing House; 2001. (Checklist of plant species of Vietnam). :
  4. . Nguyen TL. New data of freshwater Red Algae (Rhodophyta) at Ma Da area, Dong Nai province. VNU J Sci Nat Sci Technol Sci. 2010;26(1):43-6. :
  5. . Chapuis IS, Necchi O, Zuccarello GC, Xie SL, Aboal M, Castillo PMS, et al. A new genus, Volatus and four new species of Batrachospermum sensu stricto (Batrachospermales, Rhodophyta). Phycologia. 2017;56(4):454-68. :
  6. . Entwisle TJ, Vis ML, Chiasson WB, Necchi O, Sherwood AR. Systematics of the Batrachospermales (Rhodophyta)A synthesis. J Phycol. 2009;45(3):704-15. :
  7. . Evans JR, Chapuis IS, Vis ML, Evans JR, Chapuis IS, Vis ML. Adding to the freshwater red algal diversity in North America: Lympha mucosa gen. et sp. nov.(Batrachospermales, Rhodophyta). Algae. 2017 Sep 15;32(3):171-9. :
  8. . Fischer E, Gerlach J, Killmann D, Quandt D. The freshwater red algae (Batrachospermales, Rhodophyta) of Africa and Madagascar I. New species of Kumanoa, Sirodotia and the new genus Ahidranoa (Batrachospermaceae). Plant Fungal Syst. 2020;65(1):147-66. :
  9. . Rossignolo NL, Yasmin F, West JA, Ganesan EK, Necchi Junior O. Molecular and morphological evidence for a new species in the genus Sirodotia (Batrachospermales, Rhodophyta) from the State of Assam, India. Phytotaxa. 2020;437(3):121-34. :
  10. . Suzuki M, Kitayama T. A new species of the genus Sheathia (Batrachospermaceae, Rhodophyta) from Japan. Phycologia [Internet]. 2021;60(4):368-74. :
  11. . Vis ML, Necchi O, Chiasson WB, Entwisle TJ. Molecular phylogeny of the genus Kumanoa (Batrachospermales, Rhodophyta). J Phycol. 2012;48(3):750-8. :
  12. . Lam DW, Verbruggen H, Saunders GW, Vis ML. Multigene phylogeny of the red algal subclass Nemaliophycidae. Mol Phylogenet Evol. 2016;94:730-6. :
  13. . Guiry MD, Guiry GM. AlgaeBase. Worldwide electronic publication. Galway: National University of Ireland; 2022. :

Comments